The ICBR FAQ offers answers to the most common questions relating to our services and protocol. Please review the list of questions below – the answer you need may already be there. If you do not find the answer to your question here, please contact us.


Expand All General FAQs | Collapse All General FAQs

  • How do I get to ICBR?
    ICBR is located at 2033 Mowry Road, on the first floor in the South Wing of the Cancer and Genetic Research Complex at the University of Florida. Visitors may bike, drive, or ride a bus to the facility. Click here for directions.
  • What bus routes stop near ICBR?
    Please visit Gainesville’s Public Transit System website for maps, schedules, and other route information. You can also locate buses around Gainesville in real time using TransLoc.
  • Where can I park?
    Parking spaces at ICBR are limited. Visitors may request a temporary parking permit from the receptionist upon arrival. Service engineers who have an appointment will have a parking permit reserved for them.
  • Who can I contact to discuss my project?
    Please e-mail ICBR with a description of the project and an ICBR administrator will connect you with the appropriate core staff member.

myICBR Billing

Expand All myICBR Billing FAQs | Collapse All myICBR Billing FAQs

  • How does ICBR establish service fees?
    Fees are calculated on the basis of consumables used to perform the service, plus a pro-rated fraction of the expenses required for maintaining the instrument utilized in the service (if any).
  • How do I get a submission ID number?
    Submission ID numbers are generated by customers in myICBR. Customers can create a submission ID number at any time by signing in to myICBR and clicking on the Submissions tab. A myICBR kiosk available for use in ICBR lobby.
  • Why didn't I receive an invoice in the mail?
    ICBR invoices are electronic and invoice notification is delivered via e-mail. Customers can view all current and previous invoices by signing in to myICBR and clicking on the Invoices tab.
  • My grant is expiring, can you create an invoice for future work?
    No. ICBR cannot accept pre-payment. Chargers for work completed are entered in stages (as work is completed) and invoices are generated on a weekly billing cycle. Please communicate with staff and plan ahead if you have a grant deadline approaching.
  • How do I authorize or remove users from my myICBR lab account?
    The lab Investigator, Manager, or Financial user should e-mail ICBR-myICBR@ad.ufl.edu with the gatorlink of the users to be added or removed and their affiliated role.


Expand All Services FAQs | Collapse All Services FAQs

  • I'm not sure what service I am looking for, what should I do?
    E-mail ICBR with a description of your project and an ICBR administrator will connect you with the appropriate core staff member.
  • How do I utilize ICBR services?
    Customers should log in to myICBR to create submissions for services. If you do not have a myICBR account, you can request one here.
  • Does ICBR have any walk-up services?
    Yes! Customers who wish to use instruments for self service and walk-up must first be trained on the instrument by an ICBR staff member. More information is available under Self Service.
  • How do I get trained on an instrument?
    Information on instrument access and training is available on the Self Service page.
  • Which core do I use for confocal?
    ICBR offers many services in a variety of forms. We encourage you to contact us and an ICBR administrator will connect you with the appropriate core.
  • Which core do I contact for gene expression?
    ICBR offers many services in a variety of forms. We encourage you to contact us and an ICBR administrator will connect you with the appropriate core.
  • Where can I find the Hybridoma core?
    The Hybridoma core has changed its name to the Monoclonal Antibody core. You can access the Monoclonal Antibody core information here.


Expand All Samples FAQs | Collapse All Samples FAQs

  • How do I prepare a sample?
    Sample preparation differs, depending on the core and service requested. Please contact the core you are delivering your sample to for sample preparation guidelines.
  • Do I have to drop off my sample(s) in person?
    No. Samples can be delivered in person, shipped to ICBR, or dropped off at one of our drop off refrigerators located around campus. ICBR does not recommend that samples requiring extreme conditions or immediate assistance be left in sample drop off refrigerators.
  • Where can I drop off my sample(s)?
    Drop off refrigerators are located in the ICBR lobby, the Health Science Center Fisher Store, and Fifield Hall room 1253. Samples requiring extreme conditions or immediate assistance should not be left in sample drop off refrigerators.
  • Are there any shipping guidelines?
    If a sample is being shipped, please make sure that it will not arrive on a day that ICBR is closed (weekends and UF holidays). ICBR recommends that samples are shipped at the beginning of the week, to allow time for them to arrive before the weekend.

Gene Expression & Genotyping

Expand All Gene Expression & Genotyping FAQs | Collapse All Gene Expression & Genotyping FAQs

  • How do I start a project?
    Please contact us and setup a consultation, ICBR-GeneExpression@ad.ufl.edu or 352-273-8043.
  • Which technology I should choose for my gene expression study (microarray, RNAseq, single cell RNAseq qPCR or digital PCR)?
    It depends on the purpose your project. Please contact us to discuss your project and setup a consultation – ICBR-GeneExpression@ad.ufl.edu or 352-273-8043.
  • Which methods I should choose for my genotyping study (Fragment Analysis, Mouse Tail genotyping, Taqman SNP, Ampliseq, Microarray based genotyping or sequencing based genotyping)?
    General speaking, for genome-wide SNP genotyping, we recommend whole genome-wide array-based or Nextgene sequencing-based technologies. For gene-wide SNP genotyping, we recommend array-based, Ampliseq or customer designed Taqman SNP genotyping technologies. For individual SNPs, we recommend qPCR and fragment analysis. For more information, please contact us and setup a consultation, ICBR-Genotyping@ad.ufl.edu.
  • How much of a sample do I need to run a TapeStation/bioanalyzer?
    We need at least 4uL of sample to run a bioanalyzer.
  • When can I expect the results?
    The results will be sent to you by email the same day or the next day if you follow the submission guidelines.
  • Which service should I use if my total RNA samples have a range of 100-500ng/ul?
    RNA Screen Tape or Nano chip. Refer to submission guidelines.
  • Where do I deliver my TapeStation/bioanalyzer samples for Gene Expression?
    Create a myICBR submission ID first and then complete the Bioanalyzer Sample Submission Form. Deliver your samples to ICBR and place them with the completed form in a Ziploc bag in the fridge located beside the ICBR reception desk. Samples will be collected at 10 a.m. and 3 p.m. everyday.
  • I labeled my sample on the tube. Do I still have to list the sample name on the submission form?
    Yes, please list all samples on the form. It will help us prevent a missing sample or misread sample names.
  • Do I have to provide the sample concentration?
    If your sample concentration is within the suitable Screen Tape/chip range, you can indicate your concentration range and do not need to list the specific concentration. If you are unsure, a detailed sample concentration will help us find the best way to run the sample.
  • What type of material does your core accept?
    We accept total RNA and labeled or fragmented cRNA for both Agilent and Affymetrix microarray analysis.
  • What happens to leftover RNA?
    Unused RNA, cRNA and hybridization cocktails will be stored at -80C according to the ICBR Terms & Conditions It is the researcher’s responsibility to collect any unused RNA samples. Samples may be discarded without notice after six months.
  • What output files do I receive?
    You will receive a cell intensity file (CEL) for each sample submitted for Affymetrix microarray. Most array analysis software/programs accept CEL files. For Agilent Microarrays, you will receive a quality control file in PDF form and a data file in TXT form for each array.
  • How do I deliver samples to Gene Expression & Genotyping?
    Please make an appointment and drop off samples at ICBR in the CGRC, first floor, south wing. To ship, send via FedEx Overnight using dry-ice boxes. We cannot accept weekend delivery, so please ship early in the week.
    • Mail to:
      ICBR Gene Expression & Genotyping
      2033 Mowry Road
      CGRC building, ICBR Rm 165
      Gainesville, FL 32610.

Monoclonal Antibody

Expand All Monoclonal Antibody FAQs | Collapse All Monoclonal Antibody FAQs

  • How can I start a monoclonal antibody project?
    Contact the Monoclonal Antibody core ICBR-MonoclonalAntibody@ad.ufl.edu or call 352-273-8039 to arrange a brief face-to-face meeting or phone conference to discuss your needs and project in detail.
  • What is a hybridoma?
    A hybridoma is a cell arising from chemical fusion of two parental cell lines. One parent is an antibody secreting cell (usually from the spleen) isolated from an immunized animal. The other parent is a myeloma cell (a type of B-cell tumor). Hybridomas are immortal somatic cell hybrids that secrete antibodies.
  • What are monoclonal antibodies?
    Monoclonal antibodies are produced (secreted) by cloned populations of hybridoma cells.
  • What are polyclonal antibodies?
    Polyclonal antibodies are isolated from the serum of an immunized animal. There are typically thousands of different antibodies reacting with numerous epitopes (parts of the antigen recognized by the antibodies) and affinities (the strength of the antigen – antibody binding interaction) present in polyclonal antibody preparations.
  • Of what use are hybridomas and monoclonal antibodies?
    Monoclonal antibodies produced by hybridomas are used in many areas of basic scientific research, industry, human and animal medicine, and agriculture. Hybridomas that secrete antibodies can be generated for almost any substance (toxin, drugs, blood proteins, cancer cells, viruses, hormones, environmental pollutants, food products, metals, plant material). The list of substances to which monoclonal antibodies have been made is almost endless. Monoclonal antibodies are routinely used to create sensitive tests for detecting or quantitating the presence or amount of various substances. Scores of monoclonal antibody-based tests are used in human and animal clinical labs. Monoclonal antibodies can be used to isolate and purify specific compounds from complex mixtures (immunoaffinity chromatography). Monoclonal antibodies are also used therapeutically to treat diseases such as cancer.
  • Do I need monoclonal or polyclonal antibodies for my application?
    For many applications, such as immunohistochemistry and electron microscopy, polyclonal antibodies may be a more robust reagent. Choosing whether to use a polyclonal or monoclonal antibody for a certain application requires careful consideration. Sometimes a pool of well-defined monoclonal antibodies can accomplish many of the same things as a polyclonal reagent.
  • Does the Monoclonal Antibody core make polyclonal antibodies?
    Not at this time. We can provide contact information for a number of commercial vendors that provide this service.
  • How much antigen do I need to generate a monoclonal antibody?
    The amount of antigen needed to generate a monoclonal antibody varies greatly from one antigen to another. Projects involving antigens that are extremely immunogenic, such as insect lectins, may only require 0.3 – 0.6 mgs. Projects where the antigen is weakly immunogenic, such as short peptides, may require 1.0 – 5.0 mgs. General considerations that come into play when estimating amount of antigen needed include: number of mice to be immunized, dose required to generate an immune response, amount of antigen needed for performing assays on mouse serum, and hybridoma supernatants.
  • How can I find out if a certain antibody is commercially available?
    There are numerous websites that offer searchable antibody databases. Some of these sites include customer reviews and references. A few of these online resources are listed here: http://www.linscottsdirectory.com/, www.abcam.com, www.1degreebio.org, www.antibodypedia.com, www.antibodyreview.com, www.benchwise.org, www.biobrea.com, www.biocompare.com, www.citeab.com, www.pabmabs.com.
  • How long does it take to generate a custom monoclonal antibody?
    Development of a monoclonal antibody usually takes from four to six months. The time frame will vary depending on how many immunizations are required to generate an appropriate immune response in the mice.
  • Do I need to obtain my own Animal Use Approval number?
    Yes, the University of Florida Institutional Animal Care and Use Committee requires that each University of Florida investigator that contracts for work involving animals completes an Animal Use Approval Form. If your only requirement for animal use is for monoclonal antibody production by the ICBR Monoclonal Antibody core, there is an abbreviated form available at https://my.iacuc.ufl.edu.
  • How much does it cost to have a custom monoclonal antibody developed?
    The cost for the ICBR Monoclonal Antibody core to develop a custom mouse monoclonal antibody is approximately $3,000.00 to $4,000 for University of Florida investigators. Screening by Western blot, determination of antibody-antigen affinity and identification of matched antibody pairs is available for an additional cost.
  • What things should I consider before beginning a custom monoclonal antibody project?
    There are several things to carefully think about before beginning a monoclonal project, such as: Does a monoclonal or polyclonal already exist (from commercial source or a colleague) that may work for my application? Will a monoclonal or polyclonal antibody work best for my needs? Do I have enough antigen prepared to complete the project? Can I set up a relevant assay to lead to monoclonal antibodies that will suit my needs?
  • What additional services does the ICBR Monoclonal Antibody Core provide?
    Biotin labeling of monoclonal antibodies; Epitope binning (using BioLayer Interferometry) to help find matched antibody pairs; determination of antibody-antigen affinity.Mycoplasma testing

    Western blot using WES: gel-free, blot-free, automated Western instrument from ProteinSimple

    Training and access to self-service instrumentation: microplate readers (absorbance, chemiluminescence, fluorescence, Octet (BioLayer Interferometry), WES.

NextGen Sequencing

Expand All NextGen Sequencing FAQs | Collapse All NextGen Sequencing FAQs

  • How do I start a project?
    The most effective way to contact our facility is by email, ICBR-NextGenseq@ad.ufl.edu. You can also reach us by phone at 352-273-8050.
  • How do I submit my samples for sequencing?
    In order submit samples, please first create an account with ICBR (myICBR) or if already a customer, please submit a request in myICBR and obtain a submission ID. Once you have generated a submission ID in myICBR, please complete a service submission form and include it with your sample at the time of submission. All tubes MUST BE labeled clearly and consistently with the same identifying information as on the form.
  • How much of a sample do I need for sample QC on the TapeStation/bioanalyzer and the QuBIT fluorometer?
    An absolute minimum of 4ul of sample to perform these assays is needed.
  • Where do I deliver my TapeStation/bioanalyzer samples?
    Create a myICBR submission ID first and then complete the Bioanalyzer Sample Submission Form. Deliver your samples to ICBR and place them with the completed form in a Ziploc bag in the fridge located beside the ICBR reception desk. Samples will be collected at 10 a.m. and 3 p.m. everyday.
  • By our estimate we submitted a sufficient amount of sample, why did your QC indicate that we did not have enough?
    It is broadly agreed that for the purpose of NextGen sequencing, quantitation should be done using a fluorescence-based method (e.g., picoGreen, riboGreen or QUBIT). Nanodrop or any other absorbance-based methods, while useful as an indicator of purity, they tend to overestimate mass. The reason for this is that too many things absorb at 260nm, besides RNA and DNA. If you do not have access to a fluorometer, a gel can give an idea of quantity and quality, provided you include a known quantity standard in your electrophoretic run. The fluorometric methods we recommend utilize dyes that can specifically distinguish double-stranded DNA from RNA, or other substances that may absorb at or close to 260 nm. Alternatively, ICBR has a fluorescence-based quantitation service for DNA or RNA. We can perform bioanalyzer runs or fluorometric quantitation for a fee.
  • If you QC all submitted samples/libraries, why do I need to bother with providing any data about my sample/library quantity and quality?
    Our lab QC should be considered an independent verification of quality and quantity of submitted material. This does not preclude your responsibility for making sure that submitted DNA meets the requirements for the requested sequencing service. Please review carefully our sample requirements.
  • What type of Nextgen DNA Sequencing Services does your facility offer?
    ICBR currently offers sequencing services on four different platforms: IonTorrent, PacBio and illumina. Our instruments include: Ion PGM, Ion Proton, PacBio RS II, Illumina NextSeq500 and Illumina MiSeq.
  • What types of projects can be completed on the PacBio?
    The PacBio SMRT sequencing system produces extraordinarily long reads that facilitate de novo assembly processes. Long reads also work very well for sequencing full-length transcripts for isoform analysis. Because of the relatively low data throughput of a PacBio sequencing experiment (500-600 Mb), the RS II system is currently best suited for small to mid-size genomes.
  • What are the sample requirements for PacBio sequencing?
    DNA must be pure and intact. Because there is no amplification, PacBio requires more material than other sequencing systems. Required sample amounts vary from 500 ng to 30 microgram depending on the desired insert size and the application. RNA (for IsoSeq) must be intact (RIN > 8). A minimum amount of 1 ug or fluorometrically quantitated RNA is required. Please see also our sample requirements document.
  • What is the turnaround time for sequencing on any of the instrument platforms?
    Our policy is to queue projects on “first-come, first-served” basis. Turn around time varies depending on the length of the queue at the time of sample submission, and on the size of the project. An estimate for project completion time is provided to our clients at the time of sample submission.
  • Why did my sample fail to sequence?
    Sequencing success depends on many factors. Our users must pay close attention to our sample input requirements. These vary depending on the sequencing platform. When a sample does not sequence successfully, we work with our customers to identify possible causes for sample failure. The likelihood of sample failure is rare, but we are unable to guarantee the success of every sample. In such unlikely event, customers will still be expected to pay for requested services, unless we have determined that failure was due to instrument malfunction or acts of negligence while we processed your sample. Please read our customer agreement document carefully.
  • What type of sequencing data do you provide?
    Sequencing data are provided in industry standard formats. For PacBio these include: 1) the H5 files containing raw data for the reads; 2) FASTA, FASTQ and CSV files containing filtered subreads; and 3) all metadata files associated with the run. For Illumina, we provide the Bcl and FASTQ files. For Ion Torrent, the files include SFF, FASTQ, or SAM/BAM. All data are delivered in hard drives with real-time 256-bit AES hardware encryption to comply with UF’s Mobile Computing and Storage Devices Policy.
  • Who do I contact and ask questions about my project while it's being processed?
    Once you have a submitted a service request and your samples have been received, your sequencing project is assigned to one of the scientists in our group. The scientist will be the project manager for your samples. This person will serve as your point of contact for any questions related to your project. The most effective way to contact our facility is by email, ICBR-NextGenseq@ad.ufl.edu. You can also reach us by phone at 352-273-8050.
  • Where do I deliver or ship samples to NextGen Sequencing?
    You can either bring your samples to our lab or ship them frozen overnight. All samples should be accompanied by a completed service request form. To ship, send via FedEx Overnight using dry-ice boxes. We cannot accept weekend delivery, so please ship early in the week.
    • Mail to:
      ICBR NextGen Sequencing
      2033 Mowry Road
      CGRC building, ICBR Rm 178
      Gainesville, FL 32610.

Proteomics & Mass Spectrometry

Expand All Proteomics & Mass Spectrometry FAQs | Collapse All Proteomics & Mass Spectrometry FAQs

  • How do I start a project?
    If your samples are for routine analysis (protein identification of gel or solution samples, HPLC purification, MALDI analysis for determination of protein molecular weight) and you know what services you need, please set up your myICBR account and submit a request to Proteomics and Mass Spectrometry. If your samples are not for routine analysis or you are not sure what the best approach is, please email ICBR-Proteomics@ad.ufl.edu and schedule a consultation or a project meeting.
  • How do I prepare a gel or solution samples?
    For direct infusion samples, MALDI-TOF analysis or 2D-GE experiments, avoid or minimize salts in general, and desalting is recommended. Ammonium salts may be used at concentrations of 5- 25 mM.
    Avoid or minimize detergents, especially polyethylene glycols (Triton) and CHAPS. If detergent is needed use octyl β-D-glucopyranoside. Avoid viscous compounds (DMSO, glycerol). For gel samples, you can cut out the spot or band and place it in a 1.5 mL standard micro test tube. No need to add any solution. Avoid keratin contamination by using powder-free nitrile gloves when handling samples. Solution samples should not contain high concentrated detergents because they interfere with trypsin digestion. If you are not certain, please email your buffer composition to ICBR-Proteomics@ad.ufl.edu and we will review it.
  • How do I clean up a protein sample?
    Please always check with the core to determine if you need to clean your samples. If you do need to clean your protein sample, you can do either an acetone precipitation or chloroform-methanol precipitation.
  • How do I download Scaffold, ProteinPilot or Proteome Discoverer?
    For a listing of all available software at ICBR, visit the Analytical Software page.If your result is in Scaffold format, you can download a free viewer (Scaffold Q+/Q+S) to view the data.For ProteinPilot, if you have Windows Professional, you can download a temporary trial version (30 days) of ProteinPilot to view the data.For Proteome Discoverer, you can download a trial. After 60 days the trial version will only act as a viewer.
  • What is the turn-around time?
    For routine analysis such as protein identification, results take no more than two weeks. For iTRAQ or label-free shot-gun sequencing, results normally take three to six weeks. Phosphorylation identification results take two to three weeks. Turn-around time depends on instrument availability and how many samples are in the queue. We provide weekly updates on your sample status.
  • How do I deliver samples to Proteomics and Mass Spectrometry Core?
    Drop off samples without an appointment between 9 a.m. and 5 p.m. To ship, send via FedEx Overnight using dry-ice boxes. We cannot accept weekend delivery, so please ship early in the week.
    • Mail to:
      ICBR Proteomics
      2033 Mowry Road
      CGRC building, ICBR Rm 169
      Gainesville, FL 32610.

Sanger Sequencing

Expand All Sanger Sequencing FAQs | Collapse All Sanger Sequencing FAQs

  • How much DNA is required for custom sequencing?
    We require 2ug of plasmid DNA/reaction at a concentration of at least 100ng/ul and 100ng of PCR product/reaction at a concentration of at least 10ng/ul. Please contact ICBR-SangerSeq@ad.ufl.edu or 352-273-8055 or 8056 if unable to supply the required amount of DNA.
  • How much primer is required for custom sequencing??
    For custom sequencing we require 5ul of primer/reaction at a concentration of 50ng/ul or 5uM. If several samples need to be sequenced with the same primer, then 3ul/reaction is enough. We require 20ul of the primer at 100uM concentration if samples are provided in 96-well plate for high-throughput services. Primers should be 17mer-23mer with Tm preferably ranging from 55-65°C. Avoid primers that form primer-dimers or hairpin loop.
  • What universal primers are provided?
    We provide the following sequencing primers:
    • M13F/pUC (-20) – 5’ GTAAAACGACGGCCAGT
    • M13F/pUC (-40) – 5’ GTTTTCCCAGTCACGAC
    • M13R (-24) – 5’ AACAGCTATGACCATG
    • T7 Terminator – 5’ CTAGTTATTGCTCAGCGGTG
    • BGH Reverse Primer – 5’ CTAGTTATTGCTCAGCGGTG
  • How do I submit my custom sequencing order?
    All custom sequencing requests should be made electronically using our online server http://dNAlims.dNAtools.com. This is in addition to submitting the request in myICBR, which is required for billing purposes. Use the request form for submitting samples in 96-well plates for high-throughput sequencing. The directions for preparing samples can be found under 96-well sample submission guidelines.
  • When will my data be ready?
    Data for custom sequencing reactions will be ready in one to two working days and data for 96-well plates will be ready in one to three working days, depending on what time the samples were submitted and the service type requested.
  • Why did my sequencing reaction failed?
    The most common cause for the reaction to fail is the quality of the DNA or an inaccurate amount of DNA was used for the reaction. Please contact the lab for assistance in trouble shooting your poor quality or failed reactions – ICBR-SangerSeq@ad.ufl.edu or 352-273-8055 or 8056.
  • How do I deliver samples to Sanger Sequencing?
    On-Campus users:
    Bring samples to CGRC Room 178E Monday – Friday, 8 a.m. to 5 p.m. or drop-off refrigerators are located in the ICBR lobby, the Health Science Center Fisher Store, and Fifield Hall room 1253. Samples requiring extreme conditions or immediate assistance should not be left in sample drop off refrigerators. These samples are picked-up by staff at 8 a.m., 1 p.m and 3 p.m. Samples dropped off after the last pick up are processed the following working day.Off-campus users:

    Please wrap your sample tubes or place in 50ml tube conical tubes for safe shipping. Samples can be shipped via overnight mail without dry ice, and culture plates must be shipped securely on dry ice.

    • Mail to:
      ICBR Sanger Sequencing
      2033 Mowry Road
      CGRC building, ICBR Rm 178
      Gainesville, FL 32610.